Vectors for Genetic Engineering of Corynebacteria

Kaori Nakata, Masayuki Inui, Peter B. Kos, Alain A. Vertfes, and Hideaki Yukawa*

Research Institute of Innovative Technology for the Earth, 9-2 Kizugawadai, Kizu, Soraku, Kyoto 619-0292, Japan

Corynebacterium glutamicum and related species are microorganisms of biotechnological significance. These bacteria have a long history of use for the production of fine chemicals such as amino acids and organic acids. Moreover, they have recently been contemplated for the production of xenogeneic proteins, such as proteins from Mycobacteria of medical importance, given the relatively close phylogenetic relationship that exists between these two genera. In this paper, we review various molecular tools available to manipulate Corynebacteria, provide DNA sequence information on several useful vectors, and report on novel shuttle vectors for the genetic engineering of these organisms. Particularly, this series of novel plasmids enables the use of chloramphenicol, kanamycin, gentamycin, or spectinomycin resistance for positive selection in Corynebacteria. These vectors complement the various molecular biology tools available to engineer these important bioconverters and thus pave the way to their increased industrial applications. Moreover, we present evidences corroborating the view that the B. stationis plasmid pB Y503 belongs to a novel family of rolling-circle plasmids comprising pNG2 isolated from C. diphtheriae.

© 2004 American Chemical Society

Corynebacterium glutamicum is a gram-positive bacterium with moderately high GC content. It is an organism that has a long history of use in biotechnology for the production of amino acids, which represent for animal feed additives alone a global market of more than $2 billions (1-3). Furthermore, the potential of corynebacteria for xenogeneic protein production appears promising (4). The recent sequencing of its complete genome will facilitate the genetic engineering of this important bioconverter, for example by enabling rational engineering (5) as a complementary tool to classical whole-cell mutagenesis or genome shuffling (6). The numerous strains that have been isolated as glutamate-producing organisms constitute species of C. glutamicum (7), which, in the Corynebacterium-Mycobacterium-Nocardia cluster are closely related to C. acetoacidophilum, C. callunae, and G ammoniagenes. The clinical species most closely related are C. minutissimum, C. striatum, and C. xerosis (8, 9).

Genetic tools have been developed to manipulate the amino acid producing coryneform bacteria. For instance, electroporation protocols that enable the efficient transformation of corynebacterial cells at a high efficiency have been reported by several groups (10-14). Such a protocol was also developed in order to engineer G glutamicum R, a strain that exhibits several useful biotechnological characteristics, including the ability to grow on ethanol as a sole carbon source, no autolysis under starvation conditions, and a rapid growth rate. Using the protocol described by Kurusu et al. (75), C. glutamicum R cells were successfully transformed to an efficiency of approximately 104 transformants per ßg of DNA. Typically, in this procedure, cells in mid-log phase were prepared for electroporation by incubation with penicillin G as a means to weaken the cell wall. A major barrier to electroporation was demonstrated to be the restriction barrier, which is due, in C. glutamicum MJ233C, to an mrr-like restriction system, and to an mcr-like system in C. glutamicum ATCC 31831. On the other hand, no such system could be identified in C. glutamicum ATCC 13869 (16). When plasmid DNA was isolated from coryneform cells, or from a dam dem E. coli mutant such as strain JM110 (17), transformation efficiencies up to 4.0xl07 transformants per jig DNA were typically attained (16).

Conjugation is an alternative protocol that has been developed by several researchers (18-21) as conjugative plasmid DNA transfer has been observed between Gram-positive and Gram-negative bacteria (22). The success of conjugation as a gene transfer method is also explained by the observation that it enables to bypass, to some extent, the restriction barrier. Schäfer et al. (20) and van der Rest et al. (14) further used stress exposure, a well-described method to temporarily inactivate the restriction barrier, as a means to increase conjugation frequencies.

The advent of these efficient transformation techniques enabled the use of integrative plasmid DNA in order to perform gene disruption and replacement in this group of important amino acid producers (23). Many of these protocols rely on conjugative transfer of plasmids only bearing an E. coli origin of replication. An electroporation-based protocol was developed for C. glutamicum MJ233C that is also suitable for the manipulation of other strains of coryneform bacteria, reaching transformation efficiencies with integrative plasmids of up to 2.4x102 transformants per fig DNA (24).

In recent years, several useful cloning vectors, designed around endogenous plasmids (25), have been constructed, including gene expression shuttle vectors (21, 26-29). We previously reported on pBY503, a 16.4-kb cryptic plasmid from Brevibacterium stationis (30) and associated partition function (5/), plasmid pPROBE17, a promoter probe vector (52), pMV5, a transposon trap vector (33) based on the lethal phenotype conferred by the B. subtilis sacB gene (34), and pMVl 1 (Tn3/83/) and pMV23 (mi niTni/&?/), two mobile elements delivery vehicles (35).

We report in this paper on the construction of novel shuttle vectors for the manipulation of C. glutamicum.

Materials and Methods Bacterial Strains and Culture Conditions

E. co/i JM109 (/7), E. co/i JM110 (/7), and C. glutamicum R, a plasmidless strain from the laboratory collection, were used in this study. Plasmids pBLl and pMVS were from the laboratory collection. Plasmids pHSG299 and pHSG398 were obtained from Takara (Osaka, Japan). E. coli strains were grown at 37°C in LB medium supplemented with SO pg-mT1 ampicillin, 50 pg.ml'1 chloramphenicol, 50 fig ml'1 kanamycin, 10 fig ml"' gentamycin, or 200 fig ml"1 spectinomycin as appropriate. Corynebacteria were routinely grown at 33°C in AR Medium (15). Kanamycin, chloramphenicol, gentamycin, and spectinomycin were added as appropriate (50 fig ml*', 5 fig ml"', 10 fig ml"1, and 200 fig ml*1, respectively).

DNA techniques

Chromosomal DNA was isolated using the Amersham Pharmacia Biotech (UK) Genomic Prep kit. Plasmid DNA was isolated by the alkaline lysis procedure (36). Restriction endonucleases, Klenow fragment, and T4 DNA ligase were obtained from Takara (Osaka, Japan) and used as per the manufacturer's instructions. Restriction fragments were isolated when required from agarose gels with the Prep-a-Gene matrix (Bio-Rad, Richmond, CA) according to the manufacturer's instructions. All PCR were carried out in an Applied Biosystems GenAmp System 9700 as recommended by the manufacturer using the following amplification protocol: 30 cycles at temperatures of 95°C for denaturation (1 min), 54°C for annealing (1 min), and 72°C for extension (1 min).

Bacterial cells transformation

Corynebacteria were transformed by electroporation (16) using plasmid DNA purified from E. coli JM110. E. coli strains were transformed by the CaClj method (36).

DNA sequencing

We have generated a library of the DNA fragments to be sequenced using a Misonics sonicator (Farmingdale, NY) on power setting 1. The Eppendorf tube containing the DNA sample was placed in an ice bath and 8 cycles of sonication for 1 sec interrupted by 1 sec intervals were performed. The resulting random fragments were size separated on a 1% agarose gel and the fraction corresponding to the 2-3 kb pool was subsequently purified from the gel. The fragments were blunted by treatment with the Klenow fragment and ligated to £mal digested pUCl 19 plasmid DNA (obtained from Takara). The ligation mixture was used to transform E. coli JM109, recombinants were selected on IPTG-supplemented plates (36). For sequencing purposes, clones were grown overnight in 96 deep-well microtiter plates in I ml 2X-LB medium using a TAITEC Bioshaker. The corresponding plasmids were isolated in 96 well plates using the Millipore Montage Plasmid Miniprep96 kit and a Cosmotec HT Station 500 (Tokyo, Japan) simple 96-well format pipetting robot. The plasmid library thus generated was sequenced on both ends using Ml3 universal forward and reverse primers (36) and cycle sequencing using the BigDye method of ABI Biosystem Inc. in an ABI 3700 CE sequencer. The Applied Biosystems GeneAmp System 9700 was used for polymerase chain reactions as described in the DNA Techniques section. Prior to sequencing, the resulting PCR products were treated with exonuclease using the ExoSAP-IT from USB (Cleveland, OH, USA) to destroy remaining primers.

DNA sequences were analyzed as follows. The raw chromatogram files (.abi files) were collected on a personal computer running Windows 2000 (Microsoft Corp.). The chromatogram files were subsequently transferred to a SunBlade 1000 computer (Sun) with one 900 MHz 64-bit UltraSparc-III CPU, 2 GByte memory. Tlje PREGAP4 program of the Staden package (37,38) was used for clipping vector sequences, as well as for quality clipping and contamination screening after base-calling by PHRED (39, 40). BLASTX searches were carried out on the Sun computer using the stand-alone BLAST program (41) of NCBI (http://www.ncbi.nlm.nih.gov ) using matrix BLOSUM62 (42).

Nucleotide accession number

The nucleotide sequences reported in this paper appears in the EMBL and GenBank Nucleotide Sequence Databases under the accession numbers AY211882 (pCRAl) and AY211883 (pMV5).

Results

Construction of the pCRAl E. coli- C. glutamicum shuttle vector

Plasmid pCRAl is an E. coli - C. glutamicum shuttle vector that derives from the E. coli plasmid pHSG398 (Takara) and the coryneform plasmid pBLl (43). Plasmid pCRAl is 5.3-kb in size and confers chloramphenicol resistance to both organisms. Plasmid pBLl was independently isolated by several group and reported also as pAM330 {44), pWSlOl {45), and pGX1901 {46). It is a multicopy plasmid 4.46-kb in size that replicates via a rolling-circle mode (47). Plasmid pCRAl was constructed as follows. Plasmid pBLl linearized with HindlU was ligated to Hindlll linearized pHSG398 (Takara) plasmid DNA resulting in plasmid pCl. Plasmid pCl contains two open reading frames derived from pBLl that are not necessary for replication in C. glutamicum, but cause filamentation in E. coli (48). A 1.4-kb fragment containing these two ORFs was thus excised with Hpal and Pstl. Following treatment with the Klenow fragment to blunt the cohesive ends, the plasmid was recircularized using T4 DNA ligase, resulting in the shuttle vector pTKl. A linker comprising the sites Kpnl-Xhol-BgHl-Pstl-Smal(Xmal)-BamHl was generated by annealing the following oligonucleotides: CTC GAG ATC TGC AGC CCG G and GAT £CC GGG CTG CAG ATC TCG AGG TAC. The half Kpnl and BamHl sites are indicated in underlined characters. Annealing was performed by incubating the oligonucleotides at 75°C for 5 min and at room temperature until equilibrium. The linker was subsequently ligated to Kpnl and BamHl digested plasmid DNA resulting in the E. coli -Corynebacterium shuttle vector pCRAl. Plasmid pCRAl was sequenced as described in the Materials and Methods section. A restriction and genetic map of this novel shuttle vector is given in Fig. 1. The DNA sequence of the polylinker and flanking sequences is shown in Fig. 2.

Plasmid pCRAl is an ideal vector for high-level expression; nevertheless, due to its mode of replication, segregational and structural instability may be observed (49, 50), particularly when overexpressing genes whose activities are deleterious to the host strain. For cloning such genes, plasmids that replicate via a 0 mechanism provide a clear advantage as these plasmids typically benefit from higher structural and segregational stability (50).

HinélW Pvul

PmaCl 3079

HinélW Pvul

PmaCl 3079

Dra\ 1314

DraX 1653 Ball 1661 Nco\ 1697

Xba\ 2886

Xba\ 2886

Dra\ 1314

DraX 1653 Ball 1661 Nco\ 1697

EcoRi

2175

BnnW

2181

Sac\

2181

Kpn\

2187

Xho\

2192

Pst\

2200

Sma 1

2206

Bam\\\

2210

Xbal

2216

Sail

2222

Figure I. The physical and genetic map of the E. coli - C. glutamicum shuttle vector pCRA I. Only the sites that are either unique or present in two copies are indicated. Arrows give the direction oftranscription. The lac promoter is represented by pLAC, the replication origin encoding the protein coding gene by ori, and the chloramphenicol resistance gene by Cmr. MCS: multiple cloning site, the order of the restriction sites is given clockwise in the box. Numbers given for each site are coordinates.

10 Seal 20 30 40 50 60 70 80 90 100 110 120

GAATTACAAÉAGTACÏCXX^TGAGTGGCAG

250 260 270 280 290 300 310 320 330 340 350 360

CAACGCAATTAATGTGAGTTAGCT^

370 380 390 400 410 420 430 440 450 460 470 480

ACXZATGXTTACGCQGAATTCyAGCT^GGT

EcoRI SacI Kpnl XhoIBglll PstI SmalBamHI Sail PshAI

490 500 510 520 530 540 550 560 570 580 590 600

ACCAACACGAAACAACAACACAAAAAGGTTTC^CAGAAAAAAGCCT

610 620 630 640 650 660 670 680 690 700 710 720

TGCCCACTATGGTGTGCACACTGCCCACTACGGTGrrGCAATCTATTCACG^

730 740 750

CCCAGCTTTGATTAGGAGCCAGGCACATAA

Figure 2. DNA sequence of the polylinker ofpCRA I and its flanking regions. The lac promoter is indicated in bold letters. Cmr: chloramphenicol resistance, Km : kanamycin resistance, Gmr: gentamycin resistance, Spec: spectinomycin resistance. The various restriction sites in the polylinkers are given clockwise in the boxes adjacent to each plasmid together with the coordinates.

The pCRB shuttle E. coli - Corynebacterium shuttle vector series

The design used to construct vector pCRAl was optimized in order to generate a series of versatile shuttle vectors enabling rapid cloning using lacZa. complementation in E. coli and a variety of positively selectable markers (chloramphenicol, kanamycin, gentamycin, or spectinomycin). The restriction maps and genetic maps of these vectors, pCRBl, pCRB2, pCRB3, and pCRB4, are presented in Fig. 3.

Plasmid pCRB 1 was constructed as follows. Primers 2 and 3 (respectively CTC TGA TAT QGT TCC ACT GAG CGT CAG ACC, CTC TGA TAT CTC CGT CGA ACG GAA GAT CAC; the bases corresponding to the restriction sites used in cloning have been underlined) were used to amplify by PCR the entire pHSG398 plasmid. The resulting amplicon was digested with EcoRV and ligated to Hpal linearized pBLl plasmid DNA. The ligation mixture was used to transform E. coli and one of the resulting clones was selected randomly as a source of pCRBl plasmid DNA, which is 4,050-bp in size.

Plasmid pCRB2 was constructed by linearization of plasmid pHSG299 DNA using Sfal and ligation to a Hpal digested PCR fragment encoding the replication origin of plasmid pBLl. This fragment was generated using the oligonucleotides CTC TGT TAA CACA TGC AGT CAT GTC GTG CT and CTC TGJ TAA CAC AAC AAG ACC CAT CAT AGT. The resulting plasmid is 4,494-bp in size.

The gentamicin resistance gene (51) was available on an EcoRl cartridge cloned in plasmid pGP704Gm (52). Plasmid pCRBl DNA was used as a template to amplify by PCR an amplicon devoid of the chloramphenicol resistance marker, using primers 1 and 5 (respectively CTC TGA TAT CCA ATA CGC AAA CCG CCT CTC and CTC JGJ TAA CAC AAC AAG ACC CAT CAT AGT). The resulting PCR product was digested with EcoRV and Hpal and ligated to Dra\ linearized pGP704Gm plasmid DNA to yield plasmid pCRB3, 4,729-bp in size, recovered from an E. coli colony obtained following transformation ofHBlOl E. coli cells.

The 4,155-bp spectinomycin resistance shuttle vector pCRB4 was constructed by ligating the Xba\-Nde\ spectinomycin resistance cassette available on plasmid pMV5 (33) to a pCRB 1 amplicon devoid of the chloramphenicol marker and obtained as described above. The Xba\-Nde\ fragment was blunted by treatment with the Klenow fragment and ligated to the above described PCR product digested with EcoRV-Hpal.

The complete sequences of these four novel vectors have been assembled in silico based on sequence information available in public databases.

The transposon trap vector pMV5

Expression of the B. subtilis levan sucrase (53, 54) has been observed to be lethal to coryneform bacteria when these cells are grown on minimum medium supplemented with 10% sucrose (33, 34).

Dra\ 3545

Dra\ 3206

Xho\ 3532

Dra\ 3545

Dra\ 3206

Xho\ 3532

EcoR\

18

Sacl

24

Kpiil

30

5mal

34

BamH\

39

Xba\

45

Sail

51

HincU

51

&e8387l 56

Pst 1

57

Sph\

63

HindU\

69

EcoR]

18

Sac\

24

Kpn\

30

Sma\

34

BamU\

39

Xba\

45

Sail

51

HincU

51

Sre8387l 56

Pst\

57

Sph\

63

///»dill

Distillation Alcohol

Figure 3. The physical and genetic maps of the E. coli - C. glutamicum shuttle vectors pCRBl, pCRB2, pCRB3, and pCRB4. Only the sites that are either unique or present in two copies are indicated. Arrows give the direction of transcription. Numbers given for each site are coordinates.

Plasmid pMV5 has been constructed to enable the positive selection of replacement recombination events in corynebacteria. Additionally, this vector may prove useful for the cloning of mobile genetic elements from closely related species such as Rhodococcus or Mycobacterium. Construction of the transposon trap pMV5 has been reported elsewhere (J J). This vector is based on the replication origin of plasmid pB YS03, a 16.2-kb low copy number cryptic episome originating from Brevibacterium stationis IFO 12144 (31,44).

The nucleotide sequence of the replication origin of plasmid pBY503 (GenBank accession number AY211883) was determined using the corresponding fragment borne by plasmid pMV5. This fragment encodes a 1,488-bp long open reading frame whose product shares 79% similarity and 65% identity with the RepA protein of the C. diphtheriae plasmids pSV5 (Genbank accession number X57320), pNGA2 (AY061891), and pNG2 (AF492560), 73% similarity and 61% identity with the C. glutamicum plasmid pTET3 (55), 73% similarity and 60% identity with the C. efficient plasmid pCE2 (AP005225), and 66% similarity and 51% identity with the Cjeikeium plasmid pB85766 (AF486522). While the size of plasmid pBY503 and its low copy number of 4.6 per chromosome equivalent in C. glutamicum MJ233C (31) are characteristics that are typical of plasmids that replicate via a 0 mechanism (50), these observed homologies suggest that pBY503 belongs to a family of plasmids comprising members that have been demonstrated to replicate via the rolling circle mode (56). This plasmid family thus represented by pGAl (57), pSRI (58), pNG2, pNGA2, pSV5, pCE2, pB85766 and pBY503 appears distinct from the family of rolling-circle plasmids originating from staphylococci, streptococci, or lactococci (59). The view that pBY503 does not replicate via a 0 mechanism is corroborated by the observation that no typical iterons (60) could be found upstream of the repA gene. In addition, a conserved motif typical for Rep proteins encoded by rolling-circle plasmids and viruses (61), uxxYuxKxxx (where u represents a bulky hydrophobic residue such as I, L, V, M, F, Y, or W), is observed in the RepA protein of pBY503 (Table 1), with the notable exception that residue K is replaced by Q. The observation that in addition to pBY503, similar sequences are present in pTET3, pNG2, pNGA2, and pSV5 suggests that Q represents a canonical residue at this particular position. Likewise, it is noteworthy that this plasmid family seems characterized by the sequence VRGYV. Analysis of the sequence furthermore reveals an incomplete additional open reading frame, OrfX, located downstream of repA whose gene product exhibits a carboxy terminus that shows strong homologies to transport proteins: 80% similarity to a conserved hypothetical protein of C. efficient YS-3I4, 78% to a putative permease of C. glutamicum ATCC 13032, and 71% to a putative transmembrane transport protein of Streptomyces coelicolor A3 (2).

Discussion

The genetic engineering of coryneform bacteria, and particularly of C. glutamicum R, has been facilitated by recent developments in molecular biology tools and in knowledge of the DNA sequence of its

Table 1. RepA signature motif of rolling-circle plasmids

Plasmids Host uxxYuxKxxx motif

Table 1. RepA signature motif of rolling-circle plasmids

pBY503

B. stationis

VRGYVTQSKT

pTET3

C. glutamicum

VRGYVTQSKT

pGAl

C. glutamicum

VRGYVAKGQP

pSRl

C. glutamicum

VRGYVAKGQP

pEP2 (pNG2)

C diphtheriae

VRGYVAQSKS

pNGA2

C. diphtheriae

VRGYVAQSKS

pSV5

C. diphtheriae

VRGYVAQSKS

pCE2

C. efficiens

VRGYVTTSKG

pB85766

C.jeikeium

VRGYVLGNKR

chromosome (Yukawa et al., unpublished). We describe in this report the construction of versatile E. coli -C. glutamicum shuttle vectors based on the replication origin of plasmid pBLl, a high copy number episome isolated from various corynebacterial strains and whose replication mechanism involves rolling circles (47, 48). These vectors allow lacZa complementation in E. coli. Furthermore, they bear a multiple cloning site in this latter gene in order to facilitate cloning. The four different resistance markers that characterize this novel shuttle vector series, namely chloramphenicol, kanamycin, spectinomycin, and gentamycin, provide versatile molecular biology tools. These vectors complement the set of existing molecular biology tools for the genetic manipulation of these bacteria, tools that include promoters of a wide range of strengths and specificities, as well as transposon mutagenesis systems. In addition, we present evidences that the B. stationis plasmid pBY503 (JO) belongs to the distinct family of plasmids comprising pGAl (57), pSRl (5J), pNG2 (GenBank accession number AF492560), pNGA2 (AY061891), pSV5 (X57320), pCE2 (AP005225), and pB85766 (AF486522). It is noteworthy that the pNG2

miniderivative pEP2 has been demonstrated to replicate via a rolling-circle mechanism (56). Though available observations strongly promote the view that all these plasmids replicate in a similar manner, it would be worth identifying the single strand and double strand origins (50, 62) of these other plasmids using deletion derivatives, and demonstrating that they also replicate via a mechanism similar to that of pNG2. Interestingly, the partition function present in pBY503 is a cis-acting element that does not act by increasing plasmid copy number (5/), in contrast to the frwu-acting element recently identified in pGAl, which promotes copy numbers as high as 35 copies per chromosome equivalent (57).

The engineering of corynebacteria is of biotechnological significance for the production of a variety of compounds. For example, our group has successfully produced on an industrial scale numerous amino acids by fermentation, including for instance L-aspartic acid (05), L-isoleucine (64, 65), and L-valine (65). We previously described a novel industrial process for the production of these amino acids. This process is characterized by the use of intact C. glutamicum cells under conditions of repressed cell division, and is based on a combination of cell reuse and product recovery as a means to optimize the ratio of substrates transformed into useful products by circumventing the sink of energy into cellular house-keeping cycles and biomass production. In our hands, cells could be reused up to a minimum of 30 times (Fig. 4). This scheme is made possible mainly by the intrinsic property of C. glutamicum R that does not undergo autolysis under starvation conditions. Moreover, a variety of methods can be applied to limit by-product formation, such as prior heat treatment of cells in order to inactivate undesirable enzymatic reactions (65), or addition of particular reagents (64).

This process is perhaps best exemplified by the scheme we used for the production of L-aspartic acid (63). C. glutamicum (Brevibacterium flavum) strain MJ233 is a natural isolate that exhibits a strong aspartase activity. Taking advantage of this property, stoichiometric conversion of fumarate to aspartate was attained by thermal inactivation of fumarase, the enzyme at the origin of by-product (malic acid) formation. Heat treatments of 5 to 9 h at 45°C or of 2 h at 50°C were found to be optimal for achieving a 90% decrease in fiimarase activity. Furthermore, calcium ions were the sole divalent metal ions able to activate the aspartase from C. glutamicum MJ233, and addition of 0.08% weight/ volume of the detergent Tween 20 (poly-oxyethylene sorbitan monolaurate) was observed to increase aspartase activity up to 40%, presumably via an increase in cell permeability. Likewise, L-aspartic acid at a minimum concentration of 0.6 M was found to protect aspartase during heat treatment. Based on this empirical knowledge and on economic or operational considerations, the industrial aspartic acid production process was designed as a multi-phase process. The first phase comprises a cultivation step to generate biomass and a pre-reaction step to custom-design the intracellular enzyme pool. The biomass generation step is conducted under aerobic conditions at 33°C for 30 h in a pH 7.6 medium consisting of 2.3% (NHUfcSO* 0.05% K2HP04, 0.05% KH2P04, 0.05% MgS04.7H20, 0.3% yeast extract, 0.3% casamino acids, 200 ppb biotin, 100 ppb

Figure 4. The Living-Cells-Reaction process. This process is characterized by the use of a bacterial production strain that does not undergo autolysis under non-growing conditions. This property renders immobilization unnecessary and enables the use ofstandard fermentation equipment. Moreover, the rate of carbon utilization towards product production is maximized as vegetative growth and housekeeping functions are minimized. Product separation from the reaction mixture and cell recycling is performed using an ultrafiltration apparatus. Purification of secreted products such as amino acids is facilitated by the negligible contamination from intracellular materials. Moreover, temperatures and pH sub-optimal for growth can be used as a means to limit microbial contamination.

Figure 4. The Living-Cells-Reaction process. This process is characterized by the use of a bacterial production strain that does not undergo autolysis under non-growing conditions. This property renders immobilization unnecessary and enables the use ofstandard fermentation equipment. Moreover, the rate of carbon utilization towards product production is maximized as vegetative growth and housekeeping functions are minimized. Product separation from the reaction mixture and cell recycling is performed using an ultrafiltration apparatus. Purification of secreted products such as amino acids is facilitated by the negligible contamination from intracellular materials. Moreover, temperatures and pH sub-optimal for growth can be used as a means to limit microbial contamination.

thiamine hydrochloride, 0.002% FeS04.7H20, 0.002% MnS04./tH20, 2% ethanol. The pre-reaction step consists of a heat treatment at 45°C for 5 h in a mixture consisting of 3% weight/ volume cells, 750 mM L-aspartic acid, 2 M ammonium chloride, 7.5 mM calcium chloride, and 0.08% weight/ volume Tween 20. This step is designed to decrease to a negligible level the fumarase activity without significantly affecting the aspartase activity. The second phase is initiated by collecting by centrifugation heat-treated cells and by inoculating with those cells a pH 9.3 reaction mixture consisting of860 mM fumaric acid, 4 M NH4OH, 7.5 mM CaCl2. Contamination risks are kept to a minimum by conducting operations at a relatively high temperature (45°C) and at an alkaline pH. The third phase is characterized by cell recycling where, taking advantage of the physiological characteristics of C. glutamicum MJ233 (no autolysis and no leakage of intracellular macromolecules), the reaction mixture is separated from the cells by ultrafiltration, typically using a polysulfon hollow-fiber tubular type membrane that can withstand high temperatures and an alkaline pH. As a result, product concentration can reach levels up to approximately 1.3 M. The ability to reach such high product concentrations is an important industrial characteristic of this process as it facilitates the last phase, product purification.

This process thus combines rational and empirical design, and offers several advantages including an easy implementation in standard fermentation equipment, the use of living cells that do not require immobilization, in addition to decreased contamination risks and efficient downstream processing. We coined the word LCR (Living-Cell-Reaction) to encompass all modifications to this basic process, and particularly those industrial schemes where the reaction phase is performed in minimum medium devoid of biotin, an essential growth factor, such that cell growth is halted. This industrial design can be adapted to the production of numerous other fine chemicals such as amino acids or organic acids (64,65).

Notwithstanding these developments, the industrial use of coryneform bacteria would benefit from the availability of a series of vectors based on a broad-host-range plasmid replicating via a 0 mechanism, as, in contrast to typical rolling-circle plasmids (50, 59), the intrinsic properties of these episomes include high structural and segregational stability (60).

Acknowledgements

This work was supported by a grant from the Ministry of Economy, Trade & Industry (METI).

References

(/) Eggeling, L.; Sahm, H. In Metabolic Engineering; Lee, S. Y., Papoutsakis, E. T., Eds.; Marcel Dekker Inc: New York, 1999; pp 153-176.

(2) Lessard, P. A.; Guillouet, S.; Willis, L. B.; Sinskey, A. J. In The encyclopedia of biopmcess technology: fermentation, biocatafysis, and bioseparation; Flickinger, M. C., Drew, S. W., Eds.; John Wiley & Sons: New York, 1999; Vol. 2, pp 729-740.

(3) Kumagai, H. Adv Biochem Eng Biotechnol 2000, 69, 71 -85.

(4) Billman-Jacobe, H.; Wang, L.; Kortt, A.; Stewart, D.; Radford, A. Appl Environ Microbiol 1995, 61, 1610-1613.

(5) Ohnishi, J.; Mitsuhashi, S.; Hayashi, M.; Ando, S.; Yokoi, H.; Ochiai, K.; Ikeda, M. Appl Microbiol Biotechnol 2002,58, 217-223.

(<*) Zhang, Y. X.; Perry, K.; Vinci, V. A.; Powell, K.; Stemmer, W. P.; del Cardayre, S. B. Nature 2002,415,644-646.

(7) Liebl, W.; Ehrmann, M.; Ludwig, W.; Schleifer, K. H. IntJSyst Bacteriol 1991, 41, 255-260.

(8) Funke, G; von Graevenitz, A.; Clarridge, J. E., 3rd; Bernard, K. A. Clin Microbiol Rev 1997,10, 125-159.

(P) Pascual, C.; Lawson, P. A.; Farrow, J. A.; Gimenez, M. N.; Collins, M. D. Int J Syst Bacteriol 1995, 45, 724-728.

(10) Bonamy, C.; Guyonvarch, A.; Reyes, O.; David, F.; Leblon, G FEMS Microbiol Lett 1990,54, 263-269.

(11) Bonnassie, S.; Burini, J. F.; Oreglia, J.; Trautwetter, A.; Patte, J. C.; Sicard, A. M. J Gen Microbiol 1990,136, 2107-2112.

(12) Dunican, L. K.; Shivnan, E. Bio/Techniques 1990, 7, 1067.

(13) Haynes, J. A.; Britz, M. L. J Gen Microbiol 1990,136,255-263.

(14) van der Rest, M. E.; Lange, C.; Molenaar, D. Appl Microbiol Biotechnol 1999,52, 541-545.

(15) Kurasu, Y.; Kainuma, M.; Inui, M.; Satoh, Y.; Yukawa, H. Agric Biol Chem 1990, 54,443-447.

(16) Verths, A. A.; Inui, M.; Kobayashi, M.; Kurusu, Y.; Yukawa, H. Res Microbiol 1993, 144, 181-185.

(17) Yanisch-Perron, C.; Vieira, J.; Messing, J. Gene 1985,33,103-119.

(18) Reyes, O.; Guyonvarch, A.; Bonamy, C.; Salti, V; David, F.; Leblon, G Gene 1991,107,61-68.

(19) Labame, J.; Reyes, O.; Guyonvarch, A.; Leblon, G J Bacteriol 1993,175,1001-1007.

(20) Schäfer, A.; Kalinowski, J.; Puhler, A. Appl Environ Microbiol 1994, 60, 756-759.

(21) Schäfer, A.; Tauch, A.; Jager, W.; Kalinowski, J.; Thierbach, G; Puhler, A. Gene 1994, 145, 69-73.

(22) Doucet-Populaire, F.; Trieu-Cuot, P.; Andremont, A.; Courvalin, P. Antimicmb Agents Chemother 1992, 36, 502-504.

(23) Schwarzer, A.; Puhler, A. Biotechnology (N Y) 1991, P, 84-87.

(24) Verths, A. A.; Hatakeyama, K.; Inui, M.; Kobayashi, M.; Kurusu, Y.; Yukawa, H. Biosci Biotechn Biochem 1993, 57, 2036-2038.

(25) Deb, J. K.; Nath, N. FEMS Microbiol Lett 1099, / 75, 11 -20.

(26) Eikmanns, B. J.; Klcincrtz, E.; Liebl, W.; Sahm, H. Gene 1991,102,93-98.

(27) Martin, J. F.; Santamaría, R.; Sandoval, H.; del Real, G; Mateos, L. M.; Gil, J. A.; Aguilar, A. Bio/Technol 1987, 5, 137-146.

(28) Martin, J. F.; Gil, J. A. In Manual of Industrial Microbiology and Biotechnology, 2 ed.; Demain, A. L., Davies, J. E., Atlas, R. M., Cohen, G, Hershberger, C. L., Hu, W. S., Sherman, D. H., Willson, R. G, Wu, J. H. D., Eds.; American Society for Microbiology Press: Washington D.C., 1999, pp 379-391.

{29) Takagi, H.; Morinaga, Y.; Miwa, K.; Nakamori, S.; Sano, K. Agrie Biol Chem 1986, 50, 2597-2603.

(50) Satoh, Y.; Hatakeyama, K.; Kohama, K.; Kobayashi, M.; Kurusu, Y.; Yukawa, H. J Ind Microbiol 1990,5,159-165.

(31) Kurusu, Y.; Satoh, Y.; Inui, M.; Kohama, K.; Kobayashi, M.; Terasawa, M.; Yukawa, H. Appl Environ Microbiol 1991,57,759-764.

(32) Zupancic, T. J.; Kittle, J. D.; Baker, B. D.; Miller, C. J.; Palmer, D. T.; Asai, Y.; Inui, M.; Vertés, A.; Kobayashi, M.; Kurusu, Y.; et al. FEMS Microbiol Lett 1995,131,121-126.

(55) Vertés, A. A.; Inui, M.; Kobayashi, M.; Kurusu, Y.; Yukawa, H. Mol Microbiol 1994, //, 739-746.

(34) Jäger, W; Schäfer, A.; Puhler, A.; Labes, G; Wohlleben, W. J Bacterio/1992,174,5462-5465.

(35) Vertés, A. A.; Asai, Y.; Inui, M.; Kobayashi, M.; Kurusu, Y.; Yukawa, H. Mol Gen Genet 1994, 245,397-405.

(36) Sambrook, J.; Russell, D. W. Molecular cloning: a laboratory manual, 3rd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y., 2001.

(37) Bonfield, J. K.; Smith, K.; Staden, R. Nucleic Acids Res 1995,23,4992-4999. (39) Staden, R. Mol Biotechnol 1996,5,233-241.

(39) Ewing, B.; Hittier, L.; Wendl, M. C.; Green, P. Genome Res 1998, 175-185.

(40) Ewing, B.; Green, P. Genome Res 1998,8,186-194.

(41) Altschul, S. F.; Madden, T. L.; SchafTer, A. A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D. J. Nucleic Acids Res 1997,25,3389-3402.

(42) Henikoff, S.; Henikoff, J. G Proc Natl Acad Sei USA 1992,89, 10915-10919.

(43) Santamaría, R.; Gil, J. A.; Mesas, J. M.; Martin, J. F. J Gen Microbiol 1984,130,2237-2246.

(44) Miwa, K.; Matsui, H.; Terabe, M.; Nakamori, S.; Sano, K.; Momose, H. Agrie Biol Chem 1984, 48,2901-2903.

(45) Yoshihama, M.; Higashiro, K.; Rao, E. A.; Akedo, M.; Shanabnich, W. G; Follettie, M. T.; Walker, G C.; Sinskey, A. J.J Bacteriol 1985,162, 591-597.

(46) Smith, M. D.; Flickinger, J. L.; Lincbergcr, D. W.; Schmidt, B. Appl Environ Microbiol 1986,51, 634-639.

(47) Fernandez-Gonzalez, C.; Cadenas, R. F.; Noirot-Gros, M. F.; Martin, J. F.; Gil, J. A. JBacteriol 1994,176, 3154-3161.

(48) Goyal, D.; Wachi, M.; Kijima, N.; Kobayashi, M.; Yukawa, H.; Nagai, K. Plasmid 1996, 36, 62-66.

(49) Ehrlich, S. D. In Mobile DNA\ Berg, D. E., Howe, M. M., Eds.; American Society for Microbiology Press: Washington D.C., 1989; pp 799-832.

(50) Jannifere, L.; Gross, A.; Ehrlich, S. D. In Bacillus subtilis and other gram-positive bacteria: biochemistry, physiology, and molecular genetics; Sonenshein, A. L., Hoch, J. A., Losick, R., Eds.; American Society for Microbiology: Washington D.C., 1993; pp 625-644.

(51) Blondelet-Rouault, M. H.; Weiser, J.; Lebrihi, A.; Branny, P.; Pernodet, J. L. Gene 1997,190, 315-317.

(52) Inui, M.; Nakata, K.; Roh, J. H.; Zahn, K.; Yukawa, H.J Bacteriol 1999,181,2689-2696.

(53) Steinmetz, M.; Le Coq, D.; Djemia, H. B.; Gay, P. Mol Gen Genet 1983,191, 138-144.

(54) Gay, P.; Le Coq, D.; Steinmetz, M.; Berkelman, T.; Kado, C. I. J Bacteriol 1985,164,918-921.

(55) Tauch, A.; Gotker, S.; Puhler, A.; Kalinowski, J.; Thierbach, G Plasmid 2002, 48,117-129.

(56) Zhang, Y.; Praszkier, J.; Hodgson, A.; Pittard, A. J.J Bacteriol 1994,176, 5718-5728.

(57) Nesvera, J.; Patek, M.; Hochmannova, J.; Abrhamova, Z.; Becvarova, V.; Jelinkova, M.; Vohradsky, J.J Bacteriol 1997,179,1525-1532.

(55) Archer, J. A.; Sinskey, A. J. J Gen Micwbiol 1993,139, 1753-1759.

(59) Khan, S. A. Microbiol Mol Biol Rev 1997, 61,442-455.

(60) del Solar, G; Giraldo, R.; Ruiz-Echevarria, M. J.; Espinosa, M.; Diaz-Orejas, R. Micwbiol Mol Biol Rev 1998, 62,434-464.

(61) Ilyina, T. V.; Koonin, E. V. Nucleic Acids Res 1992,20,3279-3285.

(62) Kramer, M. G; Khan, S. A.; Espinosa, M. Embo J1997,16,5784-5795.

(63) Yamagata, H.; Terasawa, M.; Yukawa, H. Catalysis Today 1994, 22,621 -627.

(64) Terasawa, M.; Inui, M.; Goto, M.; Kunisu, Y.; Yukawa, H. Appl Microbiol Biotechnol 1991,35, 348-351.

(65) Terasawa, M.; Inui, M.; Goto, M.; Shikata, K.; Imanari, M.; Yukawa, \\. J Ind Microbiol 1990,5, 289-294.

Was this article helpful?

0 0

Post a comment