Hrqpqhygl I A E L

GCCAGGGTGACGCTGGTGGAATAGTACCACGACCGCTTCAGGGCGATCCGCAAGGAGATGCGGGTCGCCGGAGCGGCAAAGCCCGACATTCGTTTCGCAC 1300

CGACGGCCGTCGTGAACTCGACAGTCCGCGAGAAGGGCGT ATTGCGCGGCCTGGACCTGT ACGTGGAACTGT AGCCC AT AT AT AGATTTCCAAAGAGTTT 1400

CGGCGAGGCGCGGCGCGCCT AGCC CCATGTGAGCGAGA AC CGTGCC C AGAT CAA AGAATGAGAC CGACGCGCCGGCCGCGGC A AAGGAT GAT CCT C AGGG 1500

TCGGATCTATCGCTCCGCCCTGAAGCAGGAGGGCGCACGCTGGCTGCTGACGGCGGAGGAAGGGTTGCTGGCAAAGCCCAAGCCGCCCGGCCTTGTTCCG 1600

GCACTTGAGAATGCGATCGCCATCGTCGATTACATCAACGGTACACCGCCCCATATCGCGTCCCTGGCGGAGCTTTCAACGACGCTCGGGATATCCAAGA 1700 GCCACTGTCACTCCATCCTCAAGACGCTGACGCATTTCGGCTGGCTGAAATTCGACAATCGCTCAAAGAGCTACGAGCTGAATTC

Figure 2. Nucleotide sequences of the insert DNAs of pAD108 (a) and pPD304 (b) and the deduced amino acid sequences of these DCases. The numbers at the right are nucleotide positions. Sequences similar to the —10 and —35 consensus sequences for the E. coli promoter are double-underlined, and the putative ribosome-binding site (Shine-Dalgarno) sequence and initiation and termination codons are also double-underlined. The open reading frame of the DCase is underlined.

monas putida 77 (3), which is A-carbamoyl-sarcosine ami-dohydrolase, is involved in creatinine metabolism. Olivieri et al. found DCase activity of Agrobacterium radiobacter NRRL B11291 in intact cells or a cell-free extract, together with D-hydantoinase activity (4). Yokozeki and Kubota attempted the partial purification of DCase from Pseudomonas sp. AJ11220 (5). These two enzymes were examined as to their substrate specificities and reaction profiles. They showed relatively broad substrate specificities such as for aliphatic and aromatic compounds, with strict D-form specificity, and almost the same optimal conditions, that is, pH 7 and 55-60 °C. Ogawa et al. screened enzyme producers by means of enrichment cultures with the A-carbamoyl-D-amino acids citrulline and ornithine as sole nitrogen or carbon sources. They isolated alkaliphilic and thermotolerant enzymes, which were produced by strains classified as Comamonas sp. and Blastobacter sp., respectively, purified them to homogeneity, and determined their properties (6,7). These enzymes also showed strict specificity toward A-carbamoyl-D-amino acids and hydrolyzed A-carbamoyl-amino acids having a hydrophobic side chain very efficiently; on the other hand, those having a polar group or short-chain alkyl group were only weakly hydro-lyzed.

GCATGCGCGGGGAACTGAAGAACTTGCAAGACGAACTCGGCATTACCTTCGTGCATGTAACCCATACCCAGCCTGAGGCGATCGCGCTCGCCGACATGGT 100

GGTTGTGATGGATACGGGCCGCATAGAGCAGGCAGCGAGCGCCAACGAAATCTACAACCGGCCCGCGACGCCCTATGTGGCGCGCTTCATGGGCGGCCAA 200

AACGTGTTGACGGGGAGGGTGGAGAGCATCTCGCCCACCGGCATGGTGCTGAAAAGCGAAAAGGGCGAGATCTTCAATGCGCCTCTTACGGGTGCTGCGC 300

CGAAGCTGGGCGAACCCGTATCGATATCCATGCGCCGCGACCGCATCAGCATCAGCAAGCCGCAAAACGGCAAGGGCGCGCAGCAGGCTGACGCGGTAAC 400

GGGTGTGGTCGATTCCACGGAATACCAGGGCAGCTTCGTGAAGGTCAGCATAGTGCTCGACGGTGGCGAGACCTTCGTCGCAAACATGCCCGACCATGAA 500

T T T T T CG C G GA A C CG G T GG A T CA C G GC G T C C CGGT GG T C G CC C G C T GG A A A C CGG A GC A T G T G C A T G T C C T G T C C A A G T C T G A C C GGGG C GC CG A C CA C A 600

Brew Your Own Beer

Brew Your Own Beer

Discover How To Become Your Own Brew Master, With Brew Your Own Beer. It takes more than a recipe to make a great beer. Just using the right ingredients doesn't mean your beer will taste like it was meant to. Most of the time it’s the way a beer is made and served that makes it either an exceptional beer or one that gets dumped into the nearest flower pot.

Get My Free Ebook


Post a comment